View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5841-17 (Length: 127)
Name: Solexa-NF5841-17
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5841-17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 4e-36; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 48 - 124
Target Start/End: Complemental strand, 25910696 - 25910620
Alignment:
| Q |
48 |
atttaagttttgtttgctttgtaattattattatgtgttgtatgaatgaaggtgattggaactgaggctagaggagt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25910696 |
atttaagttttgtttgctttgtaattattattatgtgttgtatgaatgaaggtgattggaactgaggctagaggagt |
25910620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 57 - 127
Target Start/End: Complemental strand, 25888080 - 25888010
Alignment:
| Q |
57 |
ttgtttgctttgtaattattattatgtgttgtatgaatgaaggtgattggaactgaggctagaggagtgta |
127 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25888080 |
ttgtttgtattgtaattattattatgtgttgtatgaatgaaggtgattggaactgaggctagaggagtgta |
25888010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 127
Target Start/End: Complemental strand, 25928486 - 25928456
Alignment:
| Q |
97 |
aggtgattggaactgaggctagaggagtgta |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25928486 |
aggtgattggaactgaggctagaggagtgta |
25928456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University