View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5841-21 (Length: 120)
Name: Solexa-NF5841-21
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5841-21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 7 - 115
Target Start/End: Complemental strand, 40644516 - 40644408
Alignment:
| Q |
7 |
acatctcagctcaagatgatgaatacaaggtatcatttcagtttcaaaagtcaaattaaagatacttgttacattttggatatcatttactcacatgtac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40644516 |
acatctcagctcaagatgatgaatacaaggtatcatttcagtttcaaaagtcaaattaaagatacttgttacattttggatatcatttactcacatacac |
40644417 |
T |
 |
| Q |
107 |
atgtttcat |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
40644416 |
atgtttcat |
40644408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University