View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5841-31 (Length: 90)
Name: Solexa-NF5841-31
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5841-31 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 3e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 21247919 - 21247837
Alignment:
| Q |
8 |
tttataatcttgtaaagaccgtcatannnnnnngttggtgtccaaattctgattgatatttcaaattatattgaaaacatatt |
90 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21247919 |
tttataatcttgtaaagaccgtcatctttttttgttagtgtccaaattctgattgatatttcaaattacattgaaaacatatt |
21247837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University