View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5841-6 (Length: 145)
Name: Solexa-NF5841-6
Description: NF5841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5841-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 145
Target Start/End: Complemental strand, 43629878 - 43629741
Alignment:
| Q |
8 |
gcttcaaaggcaggggttgagccatggttatggagagccatggttgactggtgacgttgactttggccgtgtgtttattatgggtgactcttctggcggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43629878 |
gcttcaaaggcaggggttgagccatggttatggagagccatggttgactggtgacgttgactttggccgtgtgtttattatgggtgactcttctggcggg |
43629779 |
T |
|
| Q |
108 |
aacattgcgcaccagcttgcggttcggtttggatcgga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43629778 |
aacattgcgcaccagcttgcggttcggtttggatcgga |
43629741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University