View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-1 (Length: 148)
Name: Solexa-NF5842-1
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 2378057 - 2378174
Alignment:
| Q |
1 |
agagaggtgtgtacatttaatgtctgactatgaatcagatagaattatctcttgcggcgagaacctaagaaaccnnnnnnnttgctttgggatgacctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2378057 |
agagaggtgtgtacatttaatgtctgactatgtatcggatagaattatctcttgtggcgagaacctaagaaaccaaaaaaattgcattgggatgacctcg |
2378156 |
T |
|
| Q |
101 |
cggccttcaatcaagtct |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2378157 |
cggccttcaatcaagtct |
2378174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 102 - 148
Target Start/End: Original strand, 2378175 - 2378221
Alignment:
| Q |
102 |
ggccttcaatcaagtctaatcaccagaacaagtggataagaaagtga |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2378175 |
ggccttcaatcaagtctaatcaccagaacaagtggataagaaagtga |
2378221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University