View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-15 (Length: 52)
Name: Solexa-NF5842-15
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 13409161 - 13409110
Alignment:
| Q |
1 |
aagctcttcttccaagatggctactatggagaagtttttacaccttcaagga |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13409161 |
aagctcttcttccaagatggctactatggagaagtttttacaccttcaagga |
13409110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University