View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-17 (Length: 48)
Name: Solexa-NF5842-17
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 40715677 - 40715634
Alignment:
| Q |
5 |
tgtcagaaacaaaatgcaaaggctgagagggccaagattaagta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40715677 |
tgtcagaaacaaaatgcaaaggctgagagggccaggattcagta |
40715634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University