View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-5 (Length: 140)
Name: Solexa-NF5842-5
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 6e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 2 - 86
Target Start/End: Complemental strand, 50644872 - 50644788
Alignment:
| Q |
2 |
ccatcatatacaaagagttaaactattaagggtgtcgtgaaggttcgtaaaagcatgctttcgttataaagagcattttcaggaa |
86 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
50644872 |
ccatcatatacaaggagttaaacttttaagggtgtcgtgaaggttcgtgaaagcatgctttcgttataaaaagcatttttaggaa |
50644788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 50644758 - 50644701
Alignment:
| Q |
82 |
aggaatggatagcgaatgagttcacgagacagttggcaaattttaatggctttggctt |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50644758 |
aggaatgcatagcgaatgagttcacgagacagttggcaaattttaatggctttggctt |
50644701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University