View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-7 (Length: 127)
Name: Solexa-NF5842-7
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 50645085 - 50644967
Alignment:
| Q |
8 |
ccaatatcattatattgagttagatggatgaaattacacttgatatagtggttagaggaggtaggtaatttaattagtttgagttaagggttaaagaagt |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
50645085 |
ccaatattattatattgagttagatggatgaaattacacttgatatagtggttagaggaggtaggtagtttaattagtttgagttaa-ggttaaagaagt |
50644987 |
T |
|
| Q |
108 |
tgaatgttatgtattcaaat |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50644986 |
tgaatgttatgtattcaaat |
50644967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 40904636 - 40904604
Alignment:
| Q |
77 |
ttaattagtttgagttaagggttaaagaagttg |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
40904636 |
ttaattagtttgagttaagggataaagaagttg |
40904604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University