View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5842-9 (Length: 125)
Name: Solexa-NF5842-9
Description: NF5842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5842-9 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 19542389 - 19542513
Alignment:
| Q |
1 |
gatcaacccatttagagtaactcatgtcactttgccaaatatctctcaaaatctcttcaccagtaatgtaattgctagtgccttgtcccttttttacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19542389 |
gatcaacccatttagagtaactcatgtcactttgccaaatatctctcaaaatctcttcaccagtaatgtaattactagtgccttgtcccttttttacatt |
19542488 |
T |
|
| Q |
101 |
aaatcttagtccttcatactcattc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19542489 |
aaatcttagtccttcatactcattc |
19542513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 37333217 - 37333093
Alignment:
| Q |
1 |
gatcaacccatttagagtaactcatgtcactttgccaaatatctctcaaaatctcttcaccagtaatgtaattgctagtgccttgtcccttttttacatt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |||| ||||||| |||||||||||| |||||| | | ||||||||||| ||||| | || |
|
|
| T |
37333217 |
gatcaacccattttgagtaactcatgttactttgccaagtatccctcaaaacctcttcaccagtgatgtaactatttgtgccttgtccatttttaatatc |
37333118 |
T |
|
| Q |
101 |
aaatcttagtccttcatactcattc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37333117 |
aaatcttagtccttcatactcattc |
37333093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 37324008 - 37323938
Alignment:
| Q |
1 |
gatcaacccatttagagtaactcatgtcactttgccaaatatctctcaaaatctcttcaccagtaatgtaa |
71 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37324008 |
gatcaacccattttgagtaactcatgttactttgccaaatatctctcaaaacctcttcaccactaatgtaa |
37323938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University