View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-1 (Length: 159)
Name: Solexa-NF5843-1
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-1 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 48 - 159
Target Start/End: Complemental strand, 24581647 - 24581536
Alignment:
| Q |
48 |
cacaattttcttttagaacttctcaaacgatatctttagaatttttcgtctgtatatggattgaaatggcttattttctagacaaaactcttgaggaaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24581647 |
cacaattttcttttagaacttctcaaacgatatctttagaatttttcgtctgtatatggattgaaatggcttattttctagacaaaactcttgaggaaat |
24581548 |
T |
|
| Q |
148 |
tcttgacccata |
159 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24581547 |
tcttgacccata |
24581536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 9e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 9e-16
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 36311704 - 36311750
Alignment:
| Q |
7 |
agcatcaaatgcaaagcaatactatcaatgagcctcctcagcacaat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36311704 |
agcatcaaatgcaaagcaatactatcaatgagcctcctcagtacaat |
36311750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University