View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-17 (Length: 118)
Name: Solexa-NF5843-17
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 15 - 118
Target Start/End: Original strand, 23338649 - 23338752
Alignment:
| Q |
15 |
aattgctgccacgatatgattaacgcacagcatctcatagcagctataggcaagaactatatgtaacctcacttttaaattatagaagattaaccgttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23338649 |
aattgctgccacgatatgattaacgcacagcatctcctagcagatataggcaagaactatatgtaacctcacttttaaattatagaagattaaccgttta |
23338748 |
T |
 |
| Q |
115 |
aaac |
118 |
Q |
| |
|
|||| |
|
|
| T |
23338749 |
aaac |
23338752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University