View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-18 (Length: 116)
Name: Solexa-NF5843-18
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 2081357 - 2081245
Alignment:
| Q |
4 |
tataaaagtattaaaacatatgaaagcagtttgatttgatttnnnnnnnntctgaaatataattcgaacgagttttgtaataaaacatcaaataaatttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
2081357 |
tataaaagtattaaaacatatgaaagcagtttgatttgatttaaaaaaaatttgaaatataattcgaacgaattttgtaaaaaaacattgaataaatttg |
2081258 |
T |
 |
| Q |
104 |
tgtttttagtatt |
116 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2081257 |
tgtttttagtatt |
2081245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University