View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-23 (Length: 100)
Name: Solexa-NF5843-23
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-23 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 9410978 - 9410886
Alignment:
| Q |
8 |
atgacacgtacgtgtcaatgctaaaatctatactttatttgttagattacgaattggaattggattaaccatgtttaaggtatatttgtctcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9410978 |
atgacacgtacgtgtcaatgctaaaatctatactttatttgttagattacgaattggaattggattaaccatgtttaaggtatatttgtctcg |
9410886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University