View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-26 (Length: 80)
Name: Solexa-NF5843-26
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-26 |
 |  |
|
| [»] chr2 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 7e-27; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 19327973 - 19328045
Alignment:
| Q |
8 |
tgtttcacatagttcacacttgtgcgcagtggccaaacattgttttgaacgagttgaatggggcgtgttcgat |
80 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19327973 |
tgtttgacatagctcacacttgtgcgcagtggccaaacattgttttgaacgagttgaacggggcgtgttcgat |
19328045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 19328129 - 19328201
Alignment:
| Q |
8 |
tgtttcacatagttcacacttgtgcgcagtggccaaacattgttttgaacgagttgaatggggcgtgttcgat |
80 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||||||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
19328129 |
tgtttgacacagttcacactttggcgcagtggccaaacattgttttgaacgagctgaatggcgcatgttcgat |
19328201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 19329754 - 19329816
Alignment:
| Q |
18 |
agttcacacttgtgcgcagtggccaaacattgttttgaacgagttgaatggggcgtgttcgat |
80 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||||| || |||||||| |
|
|
| T |
19329754 |
agttcacactttggcgcagtggccaaacattgtcttaaacgagttgaatgccgcatgttcgat |
19329816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 19328316 - 19328360
Alignment:
| Q |
36 |
gtggccaaacattgttttgaacgagttgaatggggcgtgttcgat |
80 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
19328316 |
gtggccaaacattgttttgaacaagttgaatggctcgtgttcgat |
19328360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 80
Target Start/End: Original strand, 19328474 - 19328517
Alignment:
| Q |
37 |
tggccaaacattgttttgaacgagttgaatggggcgtgttcgat |
80 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
19328474 |
tggccaaacattgttttgaacaagttgaatggctcgtgttcgat |
19328517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University