View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-3 (Length: 153)
Name: Solexa-NF5843-3
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 43266892 - 43267044
Alignment:
| Q |
1 |
acagacccggcgcacatcttcactagccccgcaatgaatccctttattgtagaagcatcaaacggttccctttctttcaatacaaatatctgccataagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43266892 |
acagacccggcgcacatcttcactagccctgcaatgaatccctttattgtagaagcatcaaacggttccctttctttcaatacaaatgtctgccataagt |
43266991 |
T |
|
| Q |
101 |
tagatttttccaatacctttggagtatatttggatggagggtcgttgagggag |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43266992 |
tagatttttccaatacctttggagtatatttggatggagggtcgttgagggag |
43267044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University