View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-31 (Length: 56)
Name: Solexa-NF5843-31
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 29206645 - 29206697
Alignment:
| Q |
1 |
gatccaccattggaggagtagctacatggttcatagcagaaatcagtggtatc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206645 |
gatccaccattggaggagtagctacatggttcatagcagaaatcagtggtatc |
29206697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University