View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-6 (Length: 137)
Name: Solexa-NF5843-6
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 1e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 1e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 54774612 - 54774476
Alignment:
| Q |
1 |
acttgctattaaaaatggtttgcttgccattgtctctgttgcaaatgctcttgtgacgatgtatgctaaatgtggtagccttgatgatgcggttcggact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774612 |
acttgctattaaaaatggtttgcttgccattgtctctgttgcaaatgctcttgtcacgatgtatgctaaatgtggtagccttgatgatgcggttcggact |
54774513 |
T |
 |
| Q |
101 |
tttgagttttcgggggataagaattcgattacttggt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774512 |
tttgagttttcgggggataagaattcgattacttggt |
54774476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University