View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5843-7 (Length: 136)
Name: Solexa-NF5843-7
Description: NF5843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5843-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 17341627 - 17341524
Alignment:
| Q |
1 |
agatgaaggaggaaagagcaaggagagatgaagctgttgagaagtggaaacaactttatcttgcaattaagaatgagttggatgatctcatccaaagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17341627 |
agatgaaggaggaaagagcaaggagagatgaagctgttgagaagtggaaacaactttatcttgcaattaagaatgagttggatgatctcatccaaagaac |
17341528 |
T |
 |
| Q |
101 |
atat |
104 |
Q |
| |
|
|||| |
|
|
| T |
17341527 |
atat |
17341524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University