View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-1 (Length: 222)
Name: Solexa-NF5844-1
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 54885845 - 54886059
Alignment:
| Q |
8 |
ggaatatccttacctcattcttatgctgaatttatagtagataaaagcaatttactgcttaaacggtgcataacggcagtgttatggagcctttggaaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
54885845 |
ggaatatccttacctcattcttatgctgaatttatagtagataaaagcaatttactgcttaaacagcgcatggcggcagtgttatggagcctttggaaac |
54885944 |
T |
 |
| Q |
108 |
accgtaaccttaaattgtggcaaaacgaacaagagctgtgtgttcatgttgttgatccgggctcgacacttaatggacgaatggctgtcagcgcaacctc |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54885945 |
accgtaaccttaaattttggcaaaacgaacaagagctgtgtgttcatgtttttgatccgggctcgacacttaatggacgaatggctgtcagcgcaacctc |
54886044 |
T |
 |
| Q |
208 |
actctcagccttcat |
222 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
54886045 |
agtctcagccttcat |
54886059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University