View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-10 (Length: 140)
Name: Solexa-NF5844-10
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 8e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 10522058 - 10521922
Alignment:
| Q |
1 |
ataggtgatgccaagaaattgttgtttggataatattttacttaatcaaatgagacgcaagggcatccaggttgatttggaattttcacgcttgtttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522058 |
ataggtgatgccaagaaattgttgtttggataatatttgacttaaacaaatgagacgcaagggcatccaggttgatttggaattttcacgcttgtttcta |
10521959 |
T |
|
| Q |
101 |
caattcgcctttaggatgagcgttatgtttgtcatattta |
140 |
Q |
| |
|
||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
10521958 |
caattcgtct---ggatgaacgttatgtttgtcatattta |
10521922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University