View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-15 (Length: 135)
Name: Solexa-NF5844-15
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 49808046 - 49807912
Alignment:
| Q |
1 |
catagagaaatagattatagatctaattaagggtaataagaaataccgaaattgcggccaacaatacaatgccaggtaggaccatgcctcttgtcaaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49808046 |
catagagaaatagattatagatctaattaaggggaataagaaataccgaaattgcggccaacaatacaatgccaggtaggaccatgcctcttgtcaaact |
49807947 |
T |
|
| Q |
101 |
ccttctttatagtctctgcaacatctttctctacg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49807946 |
ccttctttatagtctctgcaacatctttctctacg |
49807912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University