View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-18 (Length: 130)
Name: Solexa-NF5844-18
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-18 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 6094850 - 6094979
Alignment:
| Q |
1 |
aaaggtgacaccgagataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaacctgtcgtaccatcactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6094850 |
aaaggtgacaccgagataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaacctgtcgtaccatcactaa |
6094949 |
T |
|
| Q |
101 |
aacacccgaaatcgacattgatcttaacat |
130 |
Q |
| |
|
|||||||| |||||| ||||||||||||| |
|
|
| T |
6094950 |
aacacccggcatcgacgttgatcttaacat |
6094979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 32806067 - 32805938
Alignment:
| Q |
1 |
aaaggtgacaccgagataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaacctgtcgtaccatcactaa |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806067 |
aaaggtgacaccgaaataccatcaaatcttgtctctgcacacaaaaccagacctgcagcgttgcgcacaaccatcccccaacctgtcgtaccatcactaa |
32805968 |
T |
|
| Q |
101 |
aacacccgaaatcgacattgatcttaacat |
130 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
32805967 |
aacacccggcatcgacattgatcttaacat |
32805938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University