View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-2 (Length: 216)
Name: Solexa-NF5844-2
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-2 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 6e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 6e-62
Query Start/End: Original strand, 26 - 216
Target Start/End: Complemental strand, 9768400 - 9768213
Alignment:
| Q |
26 |
gttctttgacagctgcacctggagcaagaacactatggagaagaaatgaatcatctgaaaatggaaaagagtgagggagattatttgaacctt---gttg |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9768400 |
gttctttgatagctgcacctggagcaagaacactatggagaagaaatgaatcatctgaaaatggaaaagagtgagggagattatttgaaccttgttgttg |
9768301 |
T |
 |
| Q |
123 |
wggaggatgatatgttatctctatgactagtgatracatatcatsstscacaayrattcctgattgaggtttaattgtgtatcttgttttgata |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | || | || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9768300 |
tggaggatgatatgttatctctataactagtgatg----ctaatggtg--aaatgattcctgattgaggtttaattgtgtatcttgttttgata |
9768213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 9768345 - 9768375
Alignment:
| Q |
1 |
agatgattcatttcttctccatagtgttctt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9768345 |
agatgattcatttcttctccatagtgttctt |
9768375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University