View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-24 (Length: 125)
Name: Solexa-NF5844-24
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 7 - 124
Target Start/End: Complemental strand, 53184325 - 53184210
Alignment:
| Q |
7 |
aagttagttccaacactgacaaaatactactaacttaataacaacgtgaacaatggtatgcttaagggattggggggcatgtatgttccaacactaatgg |
106 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53184325 |
aagttagttccaacactgacaaaaaa-tactaacttaataacaacgtgaacaatggtatgcttaagggattg-ggggcatgtatgttccaacactaatgg |
53184228 |
T |
 |
| Q |
107 |
atgaaaagtgacaaaaaa |
124 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
53184227 |
atgaaaagtgataaaaaa |
53184210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University