View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-26 (Length: 119)
Name: Solexa-NF5844-26
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 52 - 116
Target Start/End: Original strand, 21376605 - 21376670
Alignment:
| Q |
52 |
ccttttcaaccgaccccc-tcctcgccgtaacaaactttcaaaacacggtaccacagtcctacctt |
116 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21376605 |
ccttttcaaccaacccccctccttgccgtaacaaactttcaaaacacggtaccacagtccttcctt |
21376670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 106
Target Start/End: Original strand, 6023409 - 6023460
Alignment:
| Q |
55 |
tttcaaccgaccccctcctcgccgtaacaaactttcaaaacacggtaccaca |
106 |
Q |
| |
|
|||||||| ||||||||||| ||||| | | ||||||||||||||||||||| |
|
|
| T |
6023409 |
tttcaacctaccccctcctctccgtaccgagctttcaaaacacggtaccaca |
6023460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University