View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-3 (Length: 160)
Name: Solexa-NF5844-3
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 2e-58
Query Start/End: Original strand, 9 - 150
Target Start/End: Complemental strand, 30000213 - 30000075
Alignment:
| Q |
9 |
aatatactataaataccatgcaatacatgttcactccaatgacaatcgtcaaggatagaagaatatccataaactgatataagkaggccacatgtaaaag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
30000213 |
aatatactataaataccatgcaatacatgttcactccaatgacaaccgtcaaggatagaa---tatccataaattgatataaggaggccacatgtaaaag |
30000117 |
T |
|
| Q |
109 |
tatgcagacaaaataaccatcactaagatgcaaacatgtata |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30000116 |
tatgtagacaaaataaccatcactaagatgcaaacatgtata |
30000075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University