View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5844-8 (Length: 147)
Name: Solexa-NF5844-8
Description: NF5844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5844-8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 52209352 - 52209249
Alignment:
| Q |
1 |
acagagaaacacatggttggaaaaactttggaaggaatcgtgactgaattattatttgaaacacttttgctaatgcaaatccaagtcattagactttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52209352 |
acagagaaacacatggttggaaaaactttggaaggaatcgtgactgaattattatttgaaacacttttgctaatgcaaatccaagtcattagactttctt |
52209253 |
T |
 |
| Q |
101 |
tgtc |
104 |
Q |
| |
|
|||| |
|
|
| T |
52209252 |
tgtc |
52209249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 120 - 147
Target Start/End: Complemental strand, 52209235 - 52209208
Alignment:
| Q |
120 |
gtcattagactttcaatcactatcaatg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52209235 |
gtcattagactttcaatcactatcaatg |
52209208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University