View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-15 (Length: 136)
Name: Solexa-NF5845-15
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 21 - 136
Target Start/End: Original strand, 4658507 - 4658622
Alignment:
| Q |
21 |
ttcatgaaaaatggacaatatttaaaattgactattgatgtaatttactaattagatgttcattctaaaccattggatctaaataatcgcagcacatata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4658507 |
ttcatgaaaaatggacaatatttaaaattgaccattgatgtaatttactaattagatgttcattctaaaccattggatctaaaaaatcgcagcacatata |
4658606 |
T |
 |
| Q |
121 |
ttcctcaatcaaacca |
136 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4658607 |
ttcctcaatcaaacca |
4658622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University