View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-20 (Length: 127)
Name: Solexa-NF5845-20
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 13213476 - 13213592
Alignment:
| Q |
10 |
tggtatatgaaactagctagctaagctacttttatttttatggaagtaaagtaaagagatggtagttcaaggtttggaggaaataaggtaataaagagtt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213476 |
tggtatatgaaactagctagctaagctactttt-tttttatggaagtaaagtaaagagatggtagttcaaggtttggaggaaataaggtaataaagagtt |
13213574 |
T |
|
| Q |
110 |
ttaagaaaagaaaagttt |
127 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13213575 |
ttaagaaaagaaaagttt |
13213592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University