View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-21 (Length: 127)
Name: Solexa-NF5845-21
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 96 - 126
Target Start/End: Complemental strand, 4658694 - 4658664
Alignment:
| Q |
96 |
gtgatgctagaagcagtgatgatgccatggc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4658694 |
gtgatgctagaagcagtgatgatgccatggc |
4658664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University