View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-24 (Length: 126)
Name: Solexa-NF5845-24
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 37135679 - 37135804
Alignment:
| Q |
1 |
tatttgtgatgtaattgtataattgtgaatttttatgtttctagaaannnnnnncttccacattcggatatgaaatcagatctataattatactagtatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135679 |
tatttgtgatgtaattgtataattgtgaatttttatgtttctagaaaaaaaattcttccacattcggatatgaaatcagatctataattatactagtatt |
37135778 |
T |
 |
| Q |
101 |
tggttttataacaatccaatatgcag |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37135779 |
tggttttataacaatccaatatgcag |
37135804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University