View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-3 (Length: 243)
Name: Solexa-NF5845-3
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 3865894 - 3865991
Alignment:
| Q |
7 |
atttgagagatgtgatttgttcaagtttagtttagttgagttgaatgaagaagtagactaatgttggttgacccaatttggtggtaatagaagggtttaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3865894 |
atttgagagatgtgatttgttcaagtt-----tagttgagttgaatgaagaagtagactaatgttggttgacccaatttggtggtaatagaagggtttga |
3865988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University