View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-30 (Length: 111)
Name: Solexa-NF5845-30
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-30 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 7 - 111
Target Start/End: Original strand, 32551152 - 32551256
Alignment:
| Q |
7 |
aattgtgcgattgattgattagggttttggaatttgagggtaatggttgaaagagaaaaggggagtatgagtgaaagttgaaattttatcgcaacaaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551152 |
aattgtgcgattgattgattagggttttggaatttgagggtaatggttgaaagagaaaaggggagtatgagtgaaagttgaaattttatcgcaacaaaaa |
32551251 |
T |
 |
| Q |
107 |
atgga |
111 |
Q |
| |
|
||||| |
|
|
| T |
32551252 |
atgga |
32551256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University