View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-31 (Length: 110)
Name: Solexa-NF5845-31
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 35296793 - 35296896
Alignment:
| Q |
7 |
aaaatataatctgtagtagctagcagtattgtaacttgtttctgacacttaaacattcttcttaaaaaggtaaaaaggcttcattgtgaccactgttgta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35296793 |
aaaatataatctgtagtagctagcagtattgtaacttgtttctgacacttaaacattcttcttaaaaaggtaaaaaggcttcattgtgaccactgttgta |
35296892 |
T |
 |
| Q |
107 |
ttta |
110 |
Q |
| |
|
|||| |
|
|
| T |
35296893 |
ttta |
35296896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University