View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-34 (Length: 87)
Name: Solexa-NF5845-34
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-34 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 9e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 4104229 - 4104150
Alignment:
| Q |
8 |
aaagggatttggagttgataatggaacaagctttgaattatgtcaatggtatataccttgttggtgatggcatggatgct |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4104229 |
aaagggatttggagttgataatggaacaagctttgaattatgtcaatggtatatcccttgttggtgatggcatggatgct |
4104150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University