View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-37 (Length: 60)
Name: Solexa-NF5845-37
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-37 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 42960268 - 42960321
Alignment:
| Q |
7 |
aagggtgactgaagtagttgaaggtaacagcagggttgtcatccacatttgtgt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960268 |
aagggtgactgaagtagttgaaggtaacagcagggttgtcatccacatttgtgt |
42960321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 60
Target Start/End: Complemental strand, 5504462 - 5504414
Alignment:
| Q |
12 |
tgactgaagtagttgaaggtaacagcagggttgtcatccacatttgtgt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||| |||||| |||| |
|
|
| T |
5504462 |
tgactgaagtagttgaaggtaacagcaggattttcattcacattggtgt |
5504414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University