View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-4 (Length: 211)
Name: Solexa-NF5845-4
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 4032985 - 4032782
Alignment:
| Q |
8 |
ctgagctcggcatgcttcgctatcttcgacgtcttaatcttcatgataatgaattctatggtgttgttccggttcagttgtttaatgctactgcacttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032985 |
ctgagctcggcatgcttcgctatcttcgacgtcttaatcttcatgataatgaattctatggtgttgttccggttcagttgtttaatgctactgcacttca |
4032886 |
T |
|
| Q |
108 |
tagtatttttcttcaccggaataatctctccggtccgtttccggcttctgtctgcaccgttccacgactccagaatctcgacctctccgataattctttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032885 |
tagtatttttcttcaccggaataatctctccggtccgtttccggcttctgtctgcaccgttccacgactccagaatctcgacctctccgataattctttc |
4032786 |
T |
|
| Q |
208 |
tctg |
211 |
Q |
| |
|
|||| |
|
|
| T |
4032785 |
tctg |
4032782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University