View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-5 (Length: 191)
Name: Solexa-NF5845-5
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 4658111 - 4658296
Alignment:
| Q |
6 |
gaatccaggaacttagaaacacaagaaccaaaggcggctaaaaagttgagcgaactagcaacaaacaaagccatcgagattcgtagatacagatgagaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4658111 |
gaatccaggaacttagaaacacaagaaccaaaggcggctaaaaagttgagcgaactagcaacaaacaaagccatcgagattcgtagatacggatgagaac |
4658210 |
T |
 |
| Q |
106 |
ccaacttcatatcgaaggcaccattttggattaggaaccaatcattaaagcgtgataaagaaagaacccaacatatgtcgcgacgg |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
4658211 |
ccaacttcatatcgaaggcaccattttagattaggaaccaatcattaaagcgcgataaagaaagaacccaacatatgtcgtgacgg |
4658296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University