View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-8 (Length: 143)
Name: Solexa-NF5845-8
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-8 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 3e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 8718335 - 8718471
Alignment:
| Q |
4 |
aagaaaggaaacaacaacaaacaagaggagggtgcctaatccaagtctgcttttgatggaaaacacgtcgtgaaaatatcgtgggattccaattcgcgtt |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8718335 |
aagaatggaaacaacaacaaacaagaggagggggcctaatccaagtctgcttttgatggaaaacacgtcgtgaaaatatcgtgggattccaattcccgtt |
8718434 |
T |
 |
| Q |
104 |
atttagctggcatttgtggattggtactggcctaatccaa |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8718435 |
atttagctggcatttgtggattgg---tggcctaatccaa |
8718471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 59 - 128
Target Start/End: Original strand, 8672078 - 8672147
Alignment:
| Q |
59 |
atggaaaacacgtcgtgaaaatatcgtgggattccaattcgcgttatttagctggcatttgtggattggt |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
8672078 |
atgggaaacacgtcgtgaaaatatcgtgggattccaattcgcgttatttagcctgcatttaaggattggt |
8672147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University