View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5845-9 (Length: 141)
Name: Solexa-NF5845-9
Description: NF5845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5845-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 2 - 141
Target Start/End: Complemental strand, 13214067 - 13213928
Alignment:
| Q |
2 |
aagaaggtgcatatagctgagagaaagaggcagtagtaaagaccaaggtttaagaattaagatagtgagtaaggttttttaccctattagtgaaagacat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13214067 |
aagaaggtgcatatagctgagagaaagaggcagtagtaaagaccaaggtttaagaattaagatagtgagtaaggttttttaccctattagtgtaagacat |
13213968 |
T |
 |
| Q |
102 |
atattaatgtgttcttatttgcagcttttccaatatagaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213967 |
atattaatgtgttcttatttgcagcttttccaatatagaa |
13213928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University