View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5846-15 (Length: 123)
Name: Solexa-NF5846-15
Description: NF5846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5846-15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 32738230 - 32738108
Alignment:
| Q |
1 |
agagacatcaagctagtgtgaatgccatagcgtgggcgccacatagttcttgtcatatttgcactgctggtgatgattctcaggcgttgatttgggatct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32738230 |
agaggcatcaagctagtgtgaatgccatagcgtgggcgccacatagttcttgtcatatttgcactgctggtgatgattctcaggcgttgatttgggatct |
32738131 |
T |
 |
| Q |
101 |
ttcttcaatgtggcagcctgttg |
123 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
32738130 |
ttcttcaatggggcagcctgttg |
32738108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University