View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5846-2 (Length: 189)
Name: Solexa-NF5846-2
Description: NF5846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5846-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 182
Target Start/End: Complemental strand, 12502560 - 12502386
Alignment:
| Q |
8 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502560 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
12502461 |
T |
|
| Q |
108 |
gttatcttgaacacattgccacttgaaagtattatgactgtgctcgcctacagaactgaccttgttcctatgctt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12502460 |
gttatcttgaacacattgccacttgaaagtattatgactgtgcttgcctacagaactgaccttgttcctatgctt |
12502386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 8 - 182
Target Start/End: Complemental strand, 12479526 - 12479352
Alignment:
| Q |
8 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
107 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
12479526 |
acatttgcagacaaatatattatttagagatatttcatctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgcgggtttttatat |
12479427 |
T |
|
| Q |
108 |
gttatcttgaacacattgccacttgaaagtattatgactgtgctcgcctacagaactgaccttgttcctatgctt |
182 |
Q |
| |
|
||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12479426 |
gttgtcttgaacacattgccaattgaaaggattatgactgtgctcgcctacagaactgaccttgttcctatgctt |
12479352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University