View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5846-20 (Length: 98)
Name: Solexa-NF5846-20
Description: NF5846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5846-20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 4 - 98
Target Start/End: Complemental strand, 34643165 - 34643071
Alignment:
| Q |
4 |
agaacagtaacaatttattcaaaattctgctatgctatagtactactgtagcctttatttaacaacactgatgtaaccctggtttacaacattga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34643165 |
agaacagtaacaatttattcaaaattctgctatgctatagtactactgtagcctttatttaacaacactgatgtaaccctggtttaaaacattga |
34643071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University