View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5846-22 (Length: 85)

Name: Solexa-NF5846-22
Description: NF5846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5846-22
Solexa-NF5846-22
[»] chr3 (1 HSPs)
chr3 (5-72)||(43335294-43335362)
[»] chr4 (1 HSPs)
chr4 (9-71)||(30257590-30257653)
[»] chr7 (2 HSPs)
chr7 (7-36)||(1763470-1763499)
chr7 (7-43)||(1764301-1764337)
[»] chr5 (1 HSPs)
chr5 (9-71)||(24099591-24099654)


Alignment Details
Target: chr3 (Bit Score: 45; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 43335362 - 43335294
Alignment:
Q  5 atattgttatgctcgaaagagcttttatacttgatgc-ttggtcattgagttgttagtacgtggatttt 72  Q
    ||||||||||||||||||||||||||||||||| ||| |||||||  |||||||| |||||||||||||    
T  43335362 atattgttatgctcgaaagagcttttatacttgttgctttggtcagggagttgttggtacgtggatttt 43335294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 71
Target Start/End: Original strand, 30257590 - 30257653
Alignment:
Q  9 tgttatgctcgaaagagcttttatacttgatgc-ttggtcattgagttgttagtacgtggattt 71  Q
    ||||||||||||||||||||||||||||| ||| ||||| |  |||||||| || |||||||||    
T  30257590 tgttatgctcgaaagagcttttatacttgctgctttggttagggagttgtttgttcgtggattt 30257653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 1763499 - 1763470
Alignment:
Q  7 attgttatgctcgaaagagcttttatactt 36  Q
    ||||||||||||||||||||||||||||||    
T  1763499 attgttatgctcgaaagagcttttatactt 1763470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 1764337 - 1764301
Alignment:
Q  7 attgttatgctcgaaagagcttttatacttgatgctt 43  Q
    ||||||||||||||||||||||||||| ||| |||||    
T  1764337 attgttatgctcgaaagagcttttataattgttgctt 1764301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 71
Target Start/End: Original strand, 24099591 - 24099654
Alignment:
Q  9 tgttatgctcgaaagagcttttatacttgatgc-ttggtcattgagttgttagtacgtggattt 71  Q
    ||||||||||||||||||||||| ||||| ||| |||||||  |||||| | || |||||||||    
T  24099591 tgttatgctcgaaagagcttttacacttgttgctttggtcagggagttgatggttcgtggattt 24099654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University