View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5846-4 (Length: 172)
Name: Solexa-NF5846-4
Description: NF5846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5846-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 9e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 38514008 - 38513849
Alignment:
| Q |
1 |
catctggagtcgctttccttttgaagggagagtatgatattgttcgtaatttcattcttcatacacttcagctgcaggtaatctcttagtcttatattac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38514008 |
catctggagtcgctttcctattgaagggagagtatgatattgttcgtaatttcattcttcatacacttcagctgcaggtaatctcttagtcttatattac |
38513909 |
T |
|
| Q |
101 |
tgatagcatgttcttggaacagaactaaatttgatacaacttcgtgtatttacatgtctg |
160 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38513908 |
tgatagcatgttcttggaacataactaaatttgatacaacttcgtgtatttacatgtctg |
38513849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University