View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-11 (Length: 142)
Name: Solexa-NF5848-11
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-11 |
 |  |
|
| [»] scaffold0189 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 47; Significance: 3e-18; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 20497 - 20543
Alignment:
| Q |
1 |
caaagggcttgagtttcaggtagttaaaaaaccatcttgtctgattc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20497 |
caaagggcttgagtttcaggtagttaaaaaaccatcttgtctgattc |
20543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 142
Target Start/End: Original strand, 20597 - 20638
Alignment:
| Q |
101 |
caggatgtactgctgtacaacttttttggcacttcaccattg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20597 |
caggatgtactgctgtacaacttttttggcacttcaccattg |
20638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University