View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-14 (Length: 140)
Name: Solexa-NF5848-14
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 3 - 140
Target Start/End: Original strand, 30238224 - 30238361
Alignment:
| Q |
3 |
gaagcataataggaatcttggcaaatgtttgagtaaagcacaagtaaattaatcacaatgataaaatcatagaagattgtcttcaaaaggtgattgaaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238224 |
gaagcataataggaatcttggcaaatgtttgagtaaagcacaagtaaattaatcacaatgataaaatcatagaagattgtcttcaaaaggtgattgaaat |
30238323 |
T |
 |
| Q |
103 |
taaacacatcacatcgatgttacattactagaggacac |
140 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30238324 |
taaacacatcacattgatgttacattactagaggacac |
30238361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University