View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-20 (Length: 136)
Name: Solexa-NF5848-20
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 9e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 9e-71
Query Start/End: Original strand, 2 - 136
Target Start/End: Original strand, 38034684 - 38034818
Alignment:
| Q |
2 |
gagagaagggtttttgagacagttgttgaaaatggtagtgttgaaatctggtggtttgtgtaagtttttgaggtcttctaggacagttgcacataatgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38034684 |
gagagaagggtttttgagacagttgttgaaaatggtagtgttgaaatctggtggtttgtgtaagtttttgaggtcttctaggacagttgcacataatgtt |
38034783 |
T |
 |
| Q |
102 |
gttttaggacataacaacgatgataaaattatagg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38034784 |
gttttaggacataacaacgatgataaaattatagg |
38034818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University