View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-27 (Length: 128)
Name: Solexa-NF5848-27
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 128
Target Start/End: Original strand, 31808974 - 31809094
Alignment:
| Q |
7 |
agtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagaaagtatagtcaactgaattatactacattgatttcatttcagttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31808974 |
agtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagagagtatagtcaactgaattatactacattgatttcatttcagttt |
31809073 |
T |
|
| Q |
107 |
tcactacaaatcaaaccacaag |
128 |
Q |
| |
|
||| |||||| ||||||||||| |
|
|
| T |
31809074 |
tca-tacaaaccaaaccacaag |
31809094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University